Nancy and Florence were distantly related friends who loved to travel and talk about the latest thing. They were on their way to visit a site where they had heard something strange was happening. Angela, someone they knew only slightly had told them all about it, and they just had to see for themselves. Angela was accompanying them.

“There it is”, Angela said as they approached one of many messy looking muddy stretches of land at the bottom of the shallow pond they were in. There was a ring of spectators looking down at what turned out to be a large patch of clay, in which something was going on.

Nancy asked, “Who is it down there, it looks like they are trapped”.

Florence answered “I think I see Gwen and Allison, and is that Charlie in the middle? What is he doing?”

They swam closer and got to the front of the ring of murmuring spectators.

Charlie seemed to be struggling and kept trying to shrug off Gwen (the two were known to be attracted to each other) while trying to do something strange with Allison. Whatever it was, she wanted no part in it, but Charlie kept trying to…well do something that seemed both impossible and ridiculous.

Angela, feeling sympathetic to Allison said, “Everyone knows that Charlie is quite unstable, but what on earth is he trying to do?”

Nancy and Florence looked at each other and nodded in agreement. They swam even closer to the point where they could hear what Charlie was raving about.

“Allison, please, just listen. I am talking about a covalent bond between us, nothing more. My phosphate and your ribosyl hydroxyl. Please, just try it.”

Allison answered, “Leave me alone you creep. I hate this clay you dragged me into. Let go.”

And then someone new arrived. The crowd hushed except for a few gasps. Nancy whispered to Florence “OMG, its Tom. The deoxy”. Florence shushed her. “Don’t be racist, they can’t help how they are”. Allison, who had a major crush on Tom broke free from Charlie and rushed to Tom’s side. They immediately paired up, and it seemed that whatever Charlie’s plan had been was finally over.

And then Uriah arrived. “Uh oh” said Nancy.

The inevitable happened (as inevitable things tend to) and the confrontation between the fully oxidized Uriah, and the deoxy Tom for Allison’s favor ended with a tussle. Poor Allison, who loved them both, finally ended up with Uriah, since she knew that unions between oxys and deoxys were frowned upon. Although this was simply a matter of cultural prejudice and had no actual basis in chemical reality. In fact, far in the future, hydrogen bonding between male and female oxys and deoxys would be critical and commonplace.

But Charlie, it turned out had not given up. When he saw Tom swimming there alone despondently, he called out. “Hey Tom, come on down here, I am trying out a new idea.” Tom didn’t really care much for Charlie, but he was friends with Charlie’s deoxy cousin Carl, and so he decided since he had nothing left to lose, to go on down.

“What are you doing, Charlie?”

“I am trying to make a chain.”

“Waddya mean a chain?”

“Look, here is my idea, suppose one of my phosphates hooks up with one of, well I mean in your case, since you only have one, with the hydroxyl of your ribose, and then YOUR phosphate hooks up with one of Gwen’s hydroxyls, and so on, we could make a long chain that would be really stable.”

Tom looked sympathetically at Charlie. “I know you’re afraid of hydrolysis Charlie. My friend Carl has the same problem. But we all hydrolyze eventually. And don’t worry, hydrolysis is not really the end, our atoms will go on and eventually form new bases and riboses, and phosphates are forever so, there is nothing to fear.”

“No Tom, that isn’t it. I mean not totally. Sure I would love to get more stable, but this idea of a chain is more than that.”

“What do you mean?”

“I am talking about something new –  a polymer, something that could lead to life.”

“Lead to what?”

“Life. A complex chemical system that would be self sustaining, with homeostasis, self replication, energy conversion and eventually evolution into all kinds of forms.”

“Charlie, what kind of a nucleotide are you? You sound insane.”

“Come on give it a try, I am tired of trying to convince these silly pyrimidines, They either want to hydrogen bond up with me, (he tried pushing Gwen away again) or they flee.”

“OK, but nothing permanent. OK? I mean we are both purines, and I am not gay.”

Charlie answered, “No no, nothing like that, this has nothing to do with attraction. Linkage is a whole new thing.”

Tom looked around him. He could see a number of other deoxys had joined the crowd, including his friend Carl. And many of the crowd had joined Nancy and Florence near enough to hear the conversation.

He turned back to Charlie. “You see Charlie, this is why we wonder about you. What does that mean ‘a new thing’. There aren’t any new things, why should there be. There are the rules, and that’s all. They don’t change and nothing can ever be as you call it, new.”

“You’ll see, Tom. Just trust me.”

“Well what is this thing you have with the clay, why do you want to do this linkage thing in all this solid mess.”

“Good question. I think the clay can act as a catalyst to facilitate the linkage reactions between the high energy phosphate bond which, when broken, can power the bond to the hydroxyl oxygen.”

After another half hour of chemistry talk between Charlie and Tom, Tom finally agreed and Charlie got to work. It didn’t go as easily as planned. Charlie began to wonder if it had been a good idea after all to recruit a deoxy for his chain. But finally it worked, (after they submerged themselves in the clay, and no water at all was around). They were linked.

Charlie was ecstatic. The onlookers were horrified. Gwen was intrigued.

“Charlie, dear, is that what you wanted to do with me?”

“Yes, honey, and we can still do it. Come, join Tom and I.”

So they dove back down into the clay and when they emerged, Gwen was linked to the other side of Charlie. And then, Allison, who had split up with Uriah (as was standard for such matches, they never lasted more than a few minutes) came down and started flirting again with Tom, even though he was no longer exactly a free nucleotide.

Allison joined the group and when the now quartet emerged from the clay, Charlie loudly proclaimed for all to hear.

“We are the first oligonucleotide, you can call us GCTA.”

More things happened. Tom was really uncomfortable, and eventually when the foursome underwent the inevitable hydrolysis, he escaped, and his place in the quatromer was taken by Uriah. And then others jumped in. So what had begun as GCUA, soon became ACCGCUAUGCGAAGCUGUCAUUAAC, or, as Charlie called it, the first true polynucleotide.

And boy did they have fun. Pretty soon they found that if they twisted around the right way one of the Charlies was just opposite one of Gwens, and of course they began to hydrogen bond, and kept the whole chain stuck in that bent shape. In fact, pretty soon, lots of the folks were bonding with their favorite mates, (basically Charlie and Gwen or Allison and Uriah), and the first Charlie, the man with the plan, was getting upset. “Look”, he cried out, “this isn’t working. The members of the chain cannot bond with other members of the chain, only with members of another chain. That’s the only way we are going to replicate.”

Of course nobody knew what replicate meant or what he was talking about, and why it mattered, so they paid no attention. But they were having a great time, and were probably the happiest nucleotides in the pond, until of course, the (once again) inevitable hydrolysis broke them apart, and Charlie the master of the entire project felt himself coming apart, and the entire episode was entirely forgotten by all, and never repeated.

So here’s to Charlie, a truly remarkable nucleotide with a vision, crazy as it seemed to everyone else, and was able for a brief time to actually do something new, and make a start toward that mystical, mythical thing called “life”.