The Book of Works

In a couple of months, we will reach the 10^th anniversary of this blog.

I started the blog a few days after I retired at the age of 67 and began a new life. A life of writing. It had long been a dream of mine to be a writer, but, like countless others, a few things held me back: Not being very good at it, not having the time to do it, and not knowing what I wanted to write about.

Retiring gave me some time, and now I know what I want to write about. I learned how to write by writing, and this blog was part of that learning process. I have published two books and a third is on the way. I put out an irregular Newsletter. I write posts on Facebook and X, and I write articles and even the occasional scientific paper.

You are probably wondering what this is leading up to. Here it is. I have decided to use Substack as a substitute for both my Newsletter and this blog. The advantages are many, and so far, I don’t know of any drawbacks. If all goes well, I will use the Substack to post news of my writing career (replacing my Newsletter) as well as blog posts on various topics, instead of doing so here.

If after several months things are going well, I will use the Substack exclusively  for my written communications. There will be no special section for paid subscribers; all content will be free to read.

You will be getting a welcome email from my Substack, with a chance to unsubscribe if you prefer. I hope to see you in this next iteration of my writing life. I want to take this opportunity to thank all of you who read this blog, and especially those of you who comment, and engage with the content. Peace, and blessings to all.

PS. This blog is not going away anytime soon. I will continue to maintain it for the sake of the large store of historic posts, some of which I might repost on the Substack page.

It’s OK to have enemies. When Jesus said to love our enemies, He was assuming we have them. There are two kinds of enemies lists. One kind lists the people you really don’t like or those who have hurt or maligned you. That list includes names like “Jack, Barbara, Sam…”

The other kind of enemies list has no personal names. It has descriptions of people, most of whom you have never met and don’t  know. That list contains categories of people like “Democrats, conservatives, gays, Black women, white men, rich people, immigrants, Muslims”, etc. In the time of Jesus, it could have read “Jews, slaves, Greeks, Scythians, Barbarians males, or females” (Galatians 3:28; Colossians 3:11).

I believe Jesus would ask that you love those on the first kind of list, but He would tell you to tear up that second list, because it wouldn’t be reasonable to ask you to love everyone in the specific categories of people you consider to be your enemy. I believe He would tell you to simply love all humanity by default and then make a list of those you really need to work on loving more. Paul wrote that we are all one in Jesus Christ, regardless of our membership in any category or identity group.

It isn’t easy being a Christian, and it was never supposed to be. God asks us to do and be more than we can easily do and be. We cannot totally succeed, but we can try as much as possible. And if we do, we must have faith that that will be enough. So let’s tear up our categorical enemies lists, and see everyone as Jesus did, human beings worthy of love.

Thirty years ago, at the age of 47, my life was in chaos.  Two years earlier I separated from my wife, and had lived in a series of apartments, and I was in the middle of moving to Europe. My job as a tenured professor was in jeopardy as my department chair and the Dean were trying to get rid of me for various reasons, and I was completely broke. My pregnant fiancé and I were staying in an apartment in Milan Italy that was still being renovated. Right after New Years I would need to return to New York to deal with a host of problems.

A few days before Christmas my fiance came home from shopping with a small (about 2 feet) plastic Christmas tree. It had a few ornaments on it – bells and balls, and there was a star on top. She said “better than nothing, all things considered”. She put it on top of a large cardboard box we had not yet unpacked.

I stood still in the living room, staring at the tree. “What is it?” she asked me, “What’s wrong?”

I shook my head and couldn’t speak. I could feel a tear rolling down my cheek. “This is the first Christmas tree I have ever had”. I told her.

Probably most readers know that I was born into a militantly communist and atheist family, and no religious holidays were ever celebrated or acknowledged in my house growing up. But I knew what Christmas was, it was all everybody in school and on the street ever talked about for at least two weeks in December. I heard the music in the stores, saw the plays and TV shows, learned what everyone I knew had gotten for Christmas, and had even seen some magnificent Christmas trees in my friends’ houses.

My first wife refused to have anything to do with Christmas, as it went against her own family’s (Jewish) traditions, so even as an adult, I never had a tree. Now, almost a believer, and starting to think about the possibility that God might actually be real or at least something to consider, I still thought of Christmas as a silly but cheery holiday for families and friends to celebrate being together. It was a holiday for almost everyone, but not for me, and I thought it never would be.

Yet now, there I was staring at this miniature, poor excuse for a Christmas tree in my own home, such as it was. As the tears fell from my eyes, I felt that I had finally, after so many years, and so many trials, reached a safe harbor, a place that evoked the words of my favorite Christmas carol that I used to hear in department stores in December. Those words: “All is calm, all is bright” had given my ten year old self hope and peace. And now here I was, with my own tree. Finally, finally after all that time, I began to understand the first thing about Christmas. Yes, it was about hope and peace. But perhaps, I thought, even more, it’s about joy.

The years continued to pass, and now I have a Christmas tree every year, a large real pine tree, decorated with lights, and ornaments, and presents under it. And even better, I have learned that the meaning of the holiday is to celebrate the miraculous birth of a baby who was God incarnate, who would grow to become the promised savior, the Messiah, the Son of Man.

One day, after years of struggle, I had cried out “I believe” and have been a  deeply devoted Christian ever since. After I was baptized in this faith, I came to learn the most important meaning of the day we celebrate that birth with gifts and songs, and plays and yes, with trees and ornaments. And that meaning is love.  

Amen, and Merry Christmas to all.

In 1976, on the recommendation of a friend, I went to see a film against my better judgement, since I have no interest in the sport of boxing. At that time I was the same age (30) as the leading character, Rocky Balboa (played by Sylvester Stallone). Today I am about the same age (75) as his manager in the film, Mick (played by Burgess Meredith).

I am writing this because I just saw the film again for the first time in several decades. I have always believed that Rocky is one of the 3 best movies ever made, but my reasons for loving it have changed over time. (The other two are Casablanca, and Midnight Cowboy).  While some of the sequels were also very good movies, it’s the original that I cannot watch without a surge of emotion that leaves me breathless and in tears.

Why? What is it about the film that I find so compelling, and carrying such an important message? I never quite knew, beyond the story of a miraculous success by a downtrodden “bum from the neighborhood”. Of course, that was the obvious major appeal of the film to many, including myself, who came from neighborhoods where nobody was supposed to achieve anything worthwhile.

But this time I watched the movie from a new perspective – that of a Christian. Rocky is not a Christ-like figure, quite the contrary. He is who Christ talked about – the least of these. In other words, all of us. A sinner, a man who works for a criminal, violent, barely surviving, not very bright, a loser even when he wins, a failure, a man with no future, no skills, no luck.

But what else is he? He is compassionate, he is caring, he is looking for love, he is forgiving, he is the model of a Christ follower. And of course, he is a fighter, not just in the literal sense, but in the way the Apostles were fighters. The way MLK and Mother Teresa, and so many Christian saints have been fighters. Like all of them, Rocky did not give up. And that was all it took. The strength to not give up.

This is the strength I found when Jesus came to save me. The strength to keep going, to block the blows of life, to dance around the danger, to find the opening and to persevere. Because at the end we know that someone will call our name, as Adrian called out Rocky’s name in the midst of chaos and pain and final victory. Someone will call our name and tell us we are loved. And that is the happy ending for us all. Praise Jesus, and hallelujah.

Nancy and Florence were distantly related friends who loved to travel and talk about the latest thing. They were on their way to visit a site where they had heard something strange was happening. Angela, someone they knew only slightly had told them all about it, and they just had to see for themselves. Angela was accompanying them.

“There it is”, Angela said as they approached one of many messy looking muddy stretches of land at the bottom of the shallow pond they were in. There was a ring of spectators looking down at what turned out to be a large patch of clay, in which something was going on.

Nancy asked, “Who is it down there, it looks like they are trapped”.

Florence answered “I think I see Gwen and Allison, and is that Charlie in the middle? What is he doing?”

They swam closer and got to the front of the ring of murmuring spectators.

Charlie seemed to be struggling and kept trying to shrug off Gwen (the two were known to be attracted to each other) while trying to do something strange with Allison. Whatever it was, she wanted no part in it, but Charlie kept trying to…well do something that seemed both impossible and ridiculous.

Angela, feeling sympathetic to Allison said, “Everyone knows that Charlie is quite unstable, but what on earth is he trying to do?”

Nancy and Florence looked at each other and nodded in agreement. They swam even closer to the point where they could hear what Charlie was raving about.

“Allison, please, just listen. I am talking about a covalent bond between us, nothing more. My phosphate and your ribosyl hydroxyl. Please, just try it.”

Allison answered, “Leave me alone you creep. I hate this clay you dragged me into. Let go.”

And then someone new arrived. The crowd hushed except for a few gasps. Nancy whispered to Florence “OMG, its Tom. The deoxy”. Florence shushed her. “Don’t be racist, they can’t help how they are”. Allison, who had a major crush on Tom broke free from Charlie and rushed to Tom’s side. They immediately paired up, and it seemed that whatever Charlie’s plan had been was finally over.

And then Uriah arrived. “Uh oh” said Nancy.

The inevitable happened (as inevitable things tend to) and the confrontation between the fully oxidized Uriah, and the deoxy Tom for Allison’s favor ended with a tussle. Poor Allison, who loved them both, finally ended up with Uriah, since she knew that unions between oxys and deoxys were frowned upon. Although this was simply a matter of cultural prejudice and had no actual basis in chemical reality. In fact, far in the future, hydrogen bonding between male and female oxys and deoxys would be critical and commonplace.

But Charlie, it turned out had not given up. When he saw Tom swimming there alone despondently, he called out. “Hey Tom, come on down here, I am trying out a new idea.” Tom didn’t really care much for Charlie, but he was friends with Charlie’s deoxy cousin Carl, and so he decided since he had nothing left to lose, to go on down.

“What are you doing, Charlie?”

“I am trying to make a chain.”

“Waddya mean a chain?”

“Look, here is my idea, suppose one of my phosphates hooks up with one of, well I mean in your case, since you only have one, with the hydroxyl of your ribose, and then YOUR phosphate hooks up with one of Gwen’s hydroxyls, and so on, we could make a long chain that would be really stable.”

Tom looked sympathetically at Charlie. “I know you’re afraid of hydrolysis Charlie. My friend Carl has the same problem. But we all hydrolyze eventually. And don’t worry, hydrolysis is not really the end, our atoms will go on and eventually form new bases and riboses, and phosphates are forever so, there is nothing to fear.”

“No Tom, that isn’t it. I mean not totally. Sure I would love to get more stable, but this idea of a chain is more than that.”

“What do you mean?”

“I am talking about something new –  a polymer, something that could lead to life.”

“Lead to what?”

“Life. A complex chemical system that would be self sustaining, with homeostasis, self replication, energy conversion and eventually evolution into all kinds of forms.”

“Charlie, what kind of a nucleotide are you? You sound insane.”

“Come on give it a try, I am tired of trying to convince these silly pyrimidines, They either want to hydrogen bond up with me, (he tried pushing Gwen away again) or they flee.”

“OK, but nothing permanent. OK? I mean we are both purines, and I am not gay.”

Charlie answered, “No no, nothing like that, this has nothing to do with attraction. Linkage is a whole new thing.”

Tom looked around him. He could see a number of other deoxys had joined the crowd, including his friend Carl. And many of the crowd had joined Nancy and Florence near enough to hear the conversation.

He turned back to Charlie. “You see Charlie, this is why we wonder about you. What does that mean ‘a new thing’. There aren’t any new things, why should there be. There are the rules, and that’s all. They don’t change and nothing can ever be as you call it, new.”

“You’ll see, Tom. Just trust me.”

“Well what is this thing you have with the clay, why do you want to do this linkage thing in all this solid mess.”

“Good question. I think the clay can act as a catalyst to facilitate the linkage reactions between the high energy phosphate bond which, when broken, can power the bond to the hydroxyl oxygen.”

After another half hour of chemistry talk between Charlie and Tom, Tom finally agreed and Charlie got to work. It didn’t go as easily as planned. Charlie began to wonder if it had been a good idea after all to recruit a deoxy for his chain. But finally it worked, (after they submerged themselves in the clay, and no water at all was around). They were linked.

Charlie was ecstatic. The onlookers were horrified. Gwen was intrigued.

“Charlie, dear, is that what you wanted to do with me?”

“Yes, honey, and we can still do it. Come, join Tom and I.”

So they dove back down into the clay and when they emerged, Gwen was linked to the other side of Charlie. And then, Allison, who had split up with Uriah (as was standard for such matches, they never lasted more than a few minutes) came down and started flirting again with Tom, even though he was no longer exactly a free nucleotide.

Allison joined the group and when the now quartet emerged from the clay, Charlie loudly proclaimed for all to hear.

“We are the first oligonucleotide, you can call us GCTA.”

More things happened. Tom was really uncomfortable, and eventually when the foursome underwent the inevitable hydrolysis, he escaped, and his place in the quatromer was taken by Uriah. And then others jumped in. So what had begun as GCUA, soon became ACCGCUAUGCGAAGCUGUCAUUAAC, or, as Charlie called it, the first true polynucleotide.

And boy did they have fun. Pretty soon they found that if they twisted around the right way one of the Charlies was just opposite one of Gwens, and of course they began to hydrogen bond, and kept the whole chain stuck in that bent shape. In fact, pretty soon, lots of the folks were bonding with their favorite mates, (basically Charlie and Gwen or Allison and Uriah), and the first Charlie, the man with the plan, was getting upset. “Look”, he cried out, “this isn’t working. The members of the chain cannot bond with other members of the chain, only with members of another chain. That’s the only way we are going to replicate.”

Of course nobody knew what replicate meant or what he was talking about, and why it mattered, so they paid no attention. But they were having a great time, and were probably the happiest nucleotides in the pond, until of course, the (once again) inevitable hydrolysis broke them apart, and Charlie the master of the entire project felt himself coming apart, and the entire episode was entirely forgotten by all, and never repeated.

So here’s to Charlie, a truly remarkable nucleotide with a vision, crazy as it seemed to everyone else, and was able for a brief time to actually do something new, and make a start toward that mystical, mythical thing called “life”.

The American Scientific Affiliation (ASA), the oldest and largest American organization of Christians in the sciences, will be holding its annual meeting at the Catholic University of America in Washington DC from July 26 to 29. One highlight of the conference will be a talk by Francis Collins, former Director of the NIH, on Saturday evening, July 27 at 7 PM.

Dr. Collins will be speaking at:

The Catholic University of America
Edward J Pryzbyla University Center, Great Room A&B
620 Michigan Ave., NE
Washington, District of Columbia  20064

This talk entitled  “Come Let Us Reason Together: On Truth, Science, Faith, and Trust” is free to the public, but prior registration is required to attend.

For more information and to register for the Collins talk to attend in person click the link below:.

https://network.asa3.org/events/EventDetails.aspx?id=1852065&group=

Its also possible to view Dr. Collins’ talk, as well as all the plenary talks and many of the breakout sessions online for $100. Use the following link to register for live streaming:

https://network.asa3.org/events/EventDetails.aspx?id=1852057&group=

For any questions please Contact: Becky English
becky@asa3.org

Retirement—what a lovely thought! Theoretically, I am retired. I stopped working for a full-time salary back in 2015 and started this blog. Since I retired, I have mostly sat around the house watching TV, gone for long walks, bothered my wife a lot, and started playing computer games.

Oh, and few other things also: I’m Editor-in-Chief of the online quarterly magazine God and Nature and grant writer and financial officer for a local charity (Rockville Help). I was also lay leader for my local United Methodist Church for six years, wrote and published two books on science and faith and a chapter in another one, built a social media platform of over 20 thousand followers on X (twitter) and on Facebook… Oh, and currently I am co-chair of the program committee for the upcoming ASA conference in Washington DC next month.

I mention all of this activity to illustrate how busy “retirement” can be—which brings me to why I have neglected this blog since March. For the last two months, I have been overwhelmed with finishing the first draft of my next (third) book, preparing the spring issue of God and Nature, and working on setting up the program for the ASA meeting. There have been a few times during this high-stress, high-intensity period when I have asked myself what I think it means to be retired, and whether it might not be a bad idea to rethink the whole concept. But now the Spring issue is out, the book is in the hands of its editors, and I have a brief respite.

A couple of years ago, I was given a Distinguished Career Award by the Washington Academy of Sciences. In my acceptance speech, I mentioned that I was retired, and then quoted my father (a chemist), who told me that “in science you never retire—you just stop getting paid.” How true that turned out to be.

So, while I cannot promise anything about the future, which is more in God’s hands than my own, I am hopeful that even when the deadlines for approving edits and rewrites come around, the next issue of the magazine is due, etc., I will somehow manage to have better control of the time chaos, and maybe even do a lot more things like watch entertaining programs, take longer walks, and write this blog. Pray for me.

And if you decide to retire, don’t tell anyone.

I post this often on this day, Holy Saturday.

Today is simply Saturday,  the day between. We know very little about what happened on this day, but we can imagine.  We can imagine a man, much like us. A man defeated, alone, miserable and afraid. This man, who was once called a rock, today thinks of himself as simply – Simon. Imagine him sitting in a strange house in a city not his own, staring out the window, seeing nothing but his own failure, and the loss of all of his hopes and dreams. I have felt this way at times, and perhaps you have also.

He thinks of the glorious promise that he has witnessed the past months, the miraculous and wonderful things he has seen and heard. He thinks of the Man who showed so much faith in him, the Man who has now gone, died, left them all alone, without hope or will. But most of all he thinks of his own terrible failure and betrayal. A failure that his leader had predicted, and which he himself would never have imagined possible.

Yesterday, that black day, had proven to the man once called the rock, that he was made of no more than weak, mortal, human clay. Three times he had confirmed his human cowardice, his unworthiness to lead, or even to live. On this Saturday, the man who now once again thinks of himself simply as Simon, is filled with an unimaginable despair at the loss of everything he once valued, most especially his own dignity.

Have you  been there? Have you had to face the fact that you are unworthy because of your actions? No excuses, you simply failed. The time for heroism, for standing tall, for being more than you thought you could be, the time to prove yourself truly a rock of faith, of hope, of goodness, the time had come, and you…you had failed to heed the call. In your weakness or fear, you had simply turned away, waving your hand in dismissal. “No” you said “I don’t know anything about that, Leave me alone”. And not just once, but often. And then it was over, the terrible moment passed, and you were left with only the taste of the ashes of your own personal failure, as the whole glorious edifice you believed in and had worked so hard for, came crashing down in chaos and defeat.

I have been there. That is why I have long been so fascinated by this day without a name, that lies between the day of anguish and the day of triumph. On this day, Simon sits in agony and stares, not yet knowing that tomorrow everything will change again. Today, he is still unaware of tomorrow’s miracle that will change everything in the world forever. Today is the lowest point in his life, but tomorrow he, along with his dispersed friends, will be witness to a breathtaking renewal of hope. The resurrection of tomorrow means not only the resurrection of the living God, not only the rising of the Son of Man, but also the rising of man himself. A man like Simon, weak, afraid, defeated, failed, a man whose despicable actions on the Friday have left him hopeless and full of self-loathing, also rises on Easter Sunday, and once more becomes Peter the Rock.

Like us he is all too human, and yet like us, he is capable of all that he later accomplished. I do not believe he ever forgot his acts of betrayal. But through grace and faith, and his human moral strength, he rose above them, and he fulfilled his destiny as a great fisher of men. So of all the miracles of tomorrow and the days and years that follow, for me the greatest is the miracle of the redemption of the man – the mortal, ordinary fisherman named simply, Simon.  Peace be with you on this day.

When you are afraid of being weak, you learn not to cry. That was me for most of my youth and adult life. I got angry a lot, but I never cried. At many times,  I felt lost, lonely, depressed, bitterly unhappy, but I have no memory of ever crying, except once. I was standing at the bedside of my father, who was in a coma just before he died. I began to cry, and I couldn’t stop. I was bawling; people were staring at me, and I could not control it. It was like a dam that had broken, and the water just flowed on. That was the only time that my sadness burst from me in tears.  I never cried for joy either, and while good things did happen, I never felt the kind of overwhelming joy that can lead to emotional crying.

All of that changed starting from the day that I sat alone in my car having just declared out loud that I believe in Jesus Christ as my Lord. Again, the floodgates opened, and this time it was joy that filled me and poured out of my eyes. Since then, I have become a person who cries often and easily. Perhaps its just a sign of growing old, but I think it’s more than that. I cry at beauty – mostly in music, but also at poetry or beautifully written prose. Stories of heroism, of human goodness and triumph over hardship and trouble bring me to tears.

Even my own writing sometimes chokes me up. I have appeared in videos and podcasts about my testimony on coming to faith, and a few times I had to stop, close my eyes and clear my throat. There are passages in my books that I cannot read aloud. And there are passages in many other books that leave me sobbing.  

It can be annoying, and I often feel like apologizing when it happens. I think back to my early teen years when such behavior would have earned me being called names or worse by my peers. And other times in my long, and not particularly peaceful life, the worst thing I could have done would have been to break down in tears.

But I have no urge anymore to find a way to stop crying so easily. I know (I am a biologist after all) that tears contain traces of hormones, neurotransmitters and signal transducers of various kinds, and that crying does have a physiological benefit on one’s mood. The relief that comes after having a good cry is not an illusion, but a biochemical response, at least partially.

For me, especially when it happens in church, while singing a hymn with deep meaning for me, or hearing a beautiful sermon, it’s often an expression of joy at the miracle of my conversion to faith. If I could dance, I would. If I could sing, I would. If I could jump and shout, and run around like a happy dog, I would. I cannot do those things, but I can cry, and I can only hope and trust that my God sees and understands that my tears are my words of thanks and praise. And that everyone else can understand that my words are those tears transformed into a more acceptable and communicative form of expression of the joy in my soul at being one with my God.